crispr guide rna design tool  (Benchling Inc)

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: Generation of PD-L1 CAR-T and validation of PD-L1 expression in target cells (A) Schematic of the second-generation PD-L1 CAR construct containing an anti-PD-L1 scFv, CD4 transmembrane domain, and 4-1BB/CD3ζ signaling domains and tEGFR safety switch. (B) Flow cytometry results of PD-L1 expression in HuCCT1, HuCCT1-PD-L1 KO, and SNU1079 cells. (C) Characterization of non-CAR-T and CAR-T showing 98.8% and 98.6% CD3 expression and 1.03% and 28% EGFR expression, respectively.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Biomarker Discovery, Expressing, Construct, Flow Cytometry

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: PD-L1 CAR-T delay tumor progression and reduce tumor burden in vivo (A) Longitudinal bioluminescent imaging of mice with orthotopic HuCCT1 tumors treated with PBS as a control, Non-CAR-T, or CAR-T at 7 and 14 days. (B) Quantification of total bioluminescent signal confirming significantly reduced tumor burden in CAR-T treated animals compared with both control groups. Results are reported as mean ± standard deviation (SD). Two-way ANOVA with Tukey’s multiple comparisons between tumor control and CAR-T are represented by ( p values: ∗∗ ≤0.01), and between non-CAR-T and CAR-T by ( p values: # # ≤ 0.01). n = 6 biological replicates at all days and time points with the exception of non-CAR-T week 9, where n = 5 biological replicates.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: In Vivo, Imaging, Control, Standard Deviation

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: Antigen-specific degranulation and granzyme B released by PD-L1 CAR-T (A) CD8 + T cell degranulation in response to HuCCT1 wild-type (WT) or PD-L1 knockout (KO) cells by flow cytometry after CAR-T co-culture at 6 h. (B) CD4 + T cell degranulation under the same conditions, showing CAR-T-mediated activity against WT but not KO cells. (C) Degranulation of CD8 + and CD4 + T cells in response to SNU1079 cells by flow cytometry after CART co-culture at 6 h compared with non-CAR-T controls. (D) Granzyme B release in HuCCT1 WT and KO cells following co-culture by ELISA after 72 h n = 3 technical replicates. Two-way ANOVA with Tukey’s multiple comparisons test. ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD).

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Knock-Out, Flow Cytometry, Co-Culture Assay, Activity Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: CAR-T release cytotoxic effector molecules and reduce tumor cell viability in an antigen-dependent manner (A and B) Granzyme B and perforin release from CAR-T and non-transduced T cells co-cultured with HuCCT1 (A) or SNU1079 (B) cells at 1:1 and 2:1 effector-to-target (E:T) ratios. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. (C) Luciferase viability assay of HuCCT1, PD-L1 knockout HuCCT1, or SNU1079 cells at 1:1 and 2:1 effector-to-target after 24 and 48 h. n = 6 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. ∗ p value ≤ 0.05, ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD).

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Cell Culture, Luciferase, Viability Assay, Knock-Out, Standard Deviation

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: PD-L1 CAR-T disrupt and kill tumor cells in multicellular CSFE spheroids (A) Brightfield images of HuCCT1 and SNU1079 CSFE spheroids following 24 h co-culture with non-CAR-T or CAR-T at 1:1 or 2:1 effector-to-target (E:T) ratios. Quantification of spheroid area is shown. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. Scale bar is 300 µm (B) Live/dead staining (calcein-AM/propidium iodide) and luciferase viability assays of spheroids under the same conditions. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. ∗ p value ≤ 0.05, ∗∗ p value ≤ 0.01, ∗∗∗ p value ≤ 0.001, ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD). Scale bar is 100 µm.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Co-Culture Assay, Staining, Luciferase, Standard Deviation

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: Gemcitabine upregulates PD-L1 and enhances CAR-T cytotoxicity in HuCCT1 cells (A) Schematic of experimental design for gemcitabine pretreatment. (B) Flow cytometry showing increased PD-L1 surface expression in HuCCT1 cells after Gem treatment, with maximal induction at 0.2 μM for 48 h. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. (C) Luciferase-based viability assays at both effector-to-target (E:T) ratios and at 24 and 48 h time points. n = 6 technical replicates, two-way ANOVA with Šídák’s multiple comparisons test. (D) Representative live/dead staining of HuCCT1 CSFE spheroids under the same conditions. ∗∗ p value ≤ 0.01, ∗∗∗ p value ≤ 0.001, ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD). Scale bar is 50 µm.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Flow Cytometry, Expressing, Luciferase, Staining, Standard Deviation

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: Gemcitabine upregulates PD-L1 and enhances CAR-T cytotoxicity in SNU1079 cells (A) Schematic depicting Gemcitabine pretreatment. (B) Flow cytometry showing Gemcitabine-induced PD-L1 upregulation in SNU1079 cells, with maximal effect at 0.2 μM for 48 h. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. (C) Luciferase-based viability assays at both effector-to-target (E:T) ratios and at 24 and 48 h time points. n = 6 technical replicates. Two-way ANOVA with Šídák’s multiple comparisons test. (D) Representative live/dead staining of SNU1079 CSFE spheroids under the same conditions. p value∗ ≤ 0.05, p value∗∗ ≤ 0.01, p value∗∗∗∗ ≤ 0.0001. Results are reported as mean ± standard deviation (SD). Scale bar is 50 µm.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Flow Cytometry, Luciferase, Staining, Standard Deviation

Journal: bioRxiv

Article Title: Pyridoxine supplementation confers protection against SGPL1 R222Q variant sphingosine phosphate lyase insufficiency syndrome

doi: 10.64898/2026.05.11.724358

Figure Lengend Snippet: (A) A single-guide RNA (sgRNA) containing a 20 bp target sequence, 5’ GATGGCCTGCAAAGCTTACC 3’ (Synthego) of exon 7. To introduce the mutant sequence, we designed a single-stranded 199-base oligodeoxynucleotide (SPLIS ssOligo) containing the G-to-A SPLIS mutation and a silent point mutation to create a SphI restriction enzyme site for screening: 5’AGGCTGTACCTCCTGATACCCATCCTTAACTTACTCTGGTTTCTTTTCTTCACATAG GTGACTTCTGGGGGAACGGAAAGCATCCTGATGGCATGCAAAGCTTACCAGGACTT GGCGTTAGAGAAGGGGATCAAAACTCCAGAAATGTATGGATGTGTGTGTTTGTTTCC CTTCTGATATTGTCTATTTGTGGCAGCAC 3’ (Ultramer DNA, IDT). The C57BL/6J strain was used as an embryo donor. Fertilized oocytes were injected with Cas9 protein (TrueCut Cas9 protein V2, Thermofisher), the sgRNA, and the SPLIS ssOligo and transferred to the oviducts of pseudopregnant female mice. (B) Mice were genotyped by PCR. The resulting PCR product (443 bp) was digested with SphI to detect the mutant sequence. After digestion, the WT allele yielded a 443 bp fragment; the SPLIS-modified allele yielded 275 bp and 167 bp bands. We detected 1 founder whose PCR fragment was digested by SphI (out of 99 offspring screened). Sequences of the undigested PCR fragments were determined after TOPO TA cloning (ThermoFisher) by Sanger sequencing. The founder female carried one allele containing R222Q mutation and SphI restriction site and one allele with a 38-bp deletion in exon 7, resulting in a frameshift and premature stop codon (A, B). (C) When mated with a WT male, the founder produced 4 pups, 2 Sgpl1 R222Q/WT and 2 Sgpl1 del/WT, segregating the 2 alleles.

Article Snippet: We designed a single-guide RNA (sgRNA) containing a 20 bp target sequence, 5’ GATGGCCTGCAAAGCTTACC 3’ (Synthego), on mouse exon 7.

Techniques: Sequencing, Introduce, Mutagenesis, Injection, Modification, TA Cloning, Produced

Journal: bioRxiv

Article Title: Intermolecular 3′UTR-3′UTR interactions drive Wnt gene activation through heteromeric protein assembly

doi: 10.64898/2026.05.05.723075

Figure Lengend Snippet: A. Schematic of β-catenin interaction with E-cadherin at the plasma membrane. B. Immunoblot analysis of total E-cadherin and β-catenin protein abundance in iPSCs. N = 3 clonal lines each were used, and Tubulin serves as loading control. C. Representative flow plots showing surface E-cadherin in control (dark gray), CTNNB1 KO (dark purple) and CTNNB1 Udel (dark blue) clones at the iPSC stage. The unstrained samples are shown in lighter colors. D. Quantification of the experiment from (C). Surface E-cadherin abundance was measured by MFI. Data are shown as mean ± SD from N = 3 independent experiments of N = 3 clonal lines, each. Welch’s t -test. ****, P = 2.5 x 10 -7 . E. Quantification of nuclear β-catenin relative to total β-catenin at 24h of DE differentiation from immunoblot analysis, shown in . Data are shown as mean ± SD from N = 2 independent experiments. Welch’s t- test. ns, not significant. F. Representative immunofluorescence images showing β-catenin distribution at 4h of DE differentiation. DAPI was used to stain the nucleus. Scale bar, 10 μm. G. Quantification of nuclear β-catenin from the experiment shown in (F). For each experiment, 8–10 random fields (>80 cells per experiment) were analyzed. Each dot represents the mean intensity from one experiment. Data are shown as mean ± SD from N = 3 independent experiments. Welch’s t -test. ns, not significant. H. Sanger sequencing of edited alleles of zebrafish ctnnb1 KO embryos. The guide RNA is underlined, and the cut site is indicated by the vertical dashed line. I. Representative gel image of genotyping PCR to validate zebrafish ctnnb1 3′UTR deletions using deletion-flanking primers. J. Schematic of the zebrafish ctnnb1 3′UTR deletion region. The predicted post-editing sequence is shown. Red arrowheads indicate the junction site after scarless repair. In mosaic embryos, edited PCR products were excised and analyzed by Amplicon sequencing. Sequences were aligned and composition is shown. Sequences matching the prediction are underlined; insertions are highlighted in red. K. As in , but additional zebrafish images are shown.

Article Snippet: The guide RNA pairs with the highest editing efficiency were purchased from Synthego (Table S6).

Techniques: Clinical Proteomics, Membrane, Western Blot, Quantitative Proteomics, Control, Clone Assay, Immunofluorescence, Staining, Sequencing, Amplification

Journal: bioRxiv

Article Title: Intermolecular 3′UTR-3′UTR interactions drive Wnt gene activation through heteromeric protein assembly

doi: 10.64898/2026.05.05.723075

Figure Lengend Snippet: A. Schematic of β-catenin-mediated activation of the Wnt transcriptional program. B. LEF1 mRNA expression at the indicated time points, normalized to GAPDH . Shown is mean ± SD rom N = 3 independent experiments. Welch’s t -test; *, P < 0.05; **, P < 0.01; ****, P < 0.0001. C. As in (B), but AXIN2 mRNA expression is shown. D. Immunoblot showing total β-catenin in Ctrl and Udel cells at the indicated time points. N = 2 clonal lines were examined. Tubulin serves as loading control. E. Immunoblot showing active and total β-catenin in Ctrl and Udel cells at DE 24h. N = 3 clonal lines were examined. Tubulin serves as loading control. F. Immunoblot showing nuclear and cytoplasmic β-catenin at DE 24h loaded at 1:1 ratio. Tubulin serves as loading control for cytoplasmic fraction and H3 serves as loading control for nuclear fraction. Quantification, see . G. Scatter plot showing log2FC in Udel versus Ctrl (x-axis) and log2FC in KO versus Ctrl (y-axis) at DE 24h of Wnt-responsive genes . Genes with significant changes (log2|FC| > 0.58 and FDR < 0.05) in both Udel and KO are shown in dark blue ( N = 231), whereas genes with significant change in KO only are shown in light blue ( N = 1933). Dashed lines indicate a FC of 1.5. Selected genes are indicated. Pearson’s correlation coefficient is shown. H. Gene ontology analysis of genes colored in (G). Bonferroni-corrected P values are shown. I. Shown is mean log2FC of Wnt-responsive genes with significant gene expression changes between DE 24h and stem cell state in Ctrl clones, stratified by the magnitude of induction or repression. The number of genes in the eight bins are 15, 21, 87, 290, 215, 75, 35, and 57. T-test for independent samples; ****, P < 2 x 10 -9 . J. For the genes from (I), mean log2FC in Udel versus Ctrl cells at DE 24h is shown. T-test for independent samples; *, P = 0.046; ***, P = 0.008. K. Schematic of 3′UTR loss-of-function approach of the zebrafish ctnnb1 gene. A genomic region of 776 bp is deleted using CRISPR-Cas9 and a pair of guide RNAs in fertilized eggs. At the mRNA level, this deletion results in partial deletion of the zebrafish ctnnb1 3′UTR. Embryonic defects are scored 72h after fertilization. Top panel, conserved nt between the human CTNNB1 and the zebrafish ctnnb1 3′UTR. Each line denotes an identical nt. L. Representative images showing a normal zebrafish embryo, injected with a non-targeting guide RNA (Ctrl), mild and severe abnormalities observed after injection of a pair of guide RNAs that generate a ctnnb1 3′UTR deletion (Udel) and severe abnormalities after injection of a guide RNA targeting the ctnnb1 coding sequence to generate a gene KO. Scale bar, 500 μm. M. Phenotype classification at 72h post-injection from experiment shown in (L). The total number of fish examined in each category is given. Shown is the mean fraction ± SD of the obtained phenotypes from three clutches obtained in two independent experiments. T-test for independent samples was performed; mild phenotype, uninjected (uninj) vs Udel, **, P =0.008; Uninj vs KO, ns; severe phenotype, uninj vs Udel, *, P = 0.046; uninj vs KO, ****, P = 4 x 10 -6 . N. Immunoblot showing total β-catenin obtained from zebrafish embryos at 72h post-injection. Four embryos were pooled for each sample. Actin was used as loading control. The numbers indicate relative protein abundance normalized to Actin in each sample. O. mRNA expression of lef1 and axin2 in zebrafish embryos 72 h post-injection, normalized to eef1 . Shown is mean ± SD of N = 3 mRNA preparations that each contained four different embryos. Welch’s t -test; *, P < 0.05; **, P < 0.01.

Article Snippet: The guide RNA pairs with the highest editing efficiency were purchased from Synthego (Table S6).

Techniques: Activation Assay, Expressing, Western Blot, Control, Gene Expression, Clone Assay, CRISPR, Injection, Sequencing, Quantitative Proteomics